Review



spike in template f  (Sangon Biotech)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Sangon Biotech spike in template f
    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
    Spike In Template F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/spike+in+template+f/f+in+spike+template/pmc13142104-80-0-10
    Average 86 stars, based on 1 article reviews
    spike in template f - by Bioz Stars, 2026-09
    86/100 stars

    Images

    1) Product Images from "Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice"

    Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

    Journal: STAR Protocols

    doi: 10.1016/j.xpro.2026.104537

    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
    Figure Legend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

    Techniques Used: Amplification, Purification, Control, In Vitro, Reverse Transcription



    Similar Products

    spike in template f  (Sangon Biotech)
    86
    Sangon Biotech spike in template f
    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
    Spike In Template F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/spike+in+template+f/f+in+spike+template/pmc13142104-80-0-10
    Average 86 stars, based on 1 article reviews
    spike in template f - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

    Journal: STAR Protocols

    Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

    doi: 10.1016/j.xpro.2026.104537

    Figure Lengend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

    Article Snippet: Spike-In template F , TAATACGACTCACTATAGGGAGTGAC AATGAAACCTACGTAGTGCAAAGAGA AGTGGCAGTTGCCAAATACAGCAACC TTGGTGGTGGCATGGACGAGCTGTAC AAGTAAGGTACCGGCCAT , Sangon Biotech.

    Techniques: Amplification, Purification, Control, In Vitro, Reverse Transcription